Animals
Twenty female BALB/c mice 6–8 weeks old were purchased from Jackson Laboratory (Bar Harbor, ME) and bred in the animal facility of the University of Tennessee Health Science Center. This study was performed in accordance with the PHS Policy on Humane Care and Use of Laboratory Animals and the NIH Guide for the Care and Use of Laboratory Animal Welfare Act (7 U.S.C. et seq.). The animal use protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Tennessee.
Plasmid construction
Total mRNA was isolated from Der p and Der f HDM, respectively. By using murine leukemia virus reverse transcriptase and random hexanucleotide primer following the instructions of the Perkin Elmer Gene Amp RNA PCR kit (Perkin Elmer, Branchberg, NJ), first-strand cDNA was generated from 1 μg of total RNA and subjected to reverse transcriptase polymerase chain reaction (RT-PCR). The cDNA was used in PCR with Taq polymerase with primers specific for Der p 1 (5'- CCGGAATTCGCCGCCACCATGGAAACTAACGCCTGCAGTATCAATGGA -3' and 5'- TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'), Der p 2 (5'- CCGGAATTCGCCGCCACCATGGATCAAGTCGATGTCAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAGCAAT -3'), Der p 3 (5'- CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGAAAAAGCATTAGCTG -3' and 5'- TGCTCTAGATTACTGTGAACGTTTTGATTCAATCCAATCGATA -3'), Der f 1 (5'- CCGGAATTCGCCGCCACCATGGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'- TGCTCTAGATTAGAGGTTGTTTCCGGCTTGGAAATATCCG -3'), Der f 2 (5'- CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGTTAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCACGGATTTTACCATGGGTAGCAAT -3'), and Der f 3 (5'- CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGTGAAAGCACAAGCC -3' and 5'- TGCTCTAGATTACTGTGAACGTTTTGATTCAATCCAATCGAC -3'). These primers cover the mature excreted region of each gene and include EcoR1 and Xb1 sites for cloning. The amplified PCR products were subcloned into pcDNA3.1 eukaryotic expression vector (Invitrogen, San Diego, CA) and then sequenced to verify the insertion of the correct gene with the appropriate open reading frame.
DNA preparation and vaccination
Each plasmid construct was prepared using Maxi prep (Quiagen, Chatsworth, CA). Mice were vaccinated by injection with 300 μg of pcDNA3.1 blank vector in 100 μl of phospate-buffered saline (PBS) (the control group) or the same amount of the mixed naked DNA encoding the major HDM allergens (the vaccination group) three times at weekly intervals into muscle (week 0, 1, and 2).
Immunization and inhalation of allergen
Mice were sensitized with HDM crude extract previously described [12]. HDM crude extract was emulsified with an equal volume of complete Freund adjuvant (CFA) for immunization. Three weeks after the last vaccination, mice were sensitized subcutaneously at the base of the tail with 100 μg of HDM extract in CFA. The mice were also given an intraperitoneal dose of 300 ng of purified pertussis toxin at 24 and 72 h after first immunization. Seven days later, the mice were boosted again with the same amount of antigen in incomplete Freund adjuvant. Under inhaled anesthesia with methoxyflurane, mice were challenged with 10 μg of HDM crude extract through one nostril six times at weekly intervals after immunization.
Determining total IgE, HDM-specific IgE, and HDM-specific IgG
The blood from the six mice in two groups was collected six times at week 0 (first vaccination), 3, 5 (first immunization), 7, 9, and 11. The HDM-specific IgG was determined by ELISA. One hundred microliter of HDM (5 μg/ml in 0.1 M carbonate buffer, pH 9.6) were dispensed in each well of a polystyrene microtiter plate (Cost, Cambridge, MA) and incubated overnight at 4°C. The concentration of HDM was determined by the preliminary experiments. The antigen-coated plates were washed three times in 0.05% PBS-Tween 20 buffer (washing buffer) and incubated with mice sera overnight at 4°C. The plates were washed five times with washing buffer and incubated with peroxidase-conjugated anti-mouse IgG antibody (Sigma, St. Louis, MO) overnight at 4°C. The plates were washed five times before adding citric acid-phosphate buffer (pH 5.0) containing 0.15 mg/ml of O-phenylenediamine (Sigma, St. Louis, MO). The color was developed at room temperature, and the reaction was stopped by 2.5 M sulfuric acid. The color was measured at 492 nm (Bio-Rad, Richmond, CA).
The total IgE level was determined by ELISA. One hundred microliter of anti-mouse IgE capture monoclonal antibody (mAb) (clone R35–72; Pharmingen, San Diego, CA) were added in each well to plates and incubated overnight at 4°C. After washing, 200 μL of 10% fetal calf serum were incubated at room temperature for 30 min. The plates were washed five times with washing buffer and incubated with the diluted mouse serum overnight at 4°C, followed by adding 100 μL of HRP-conjugated anti-mouse IgE detection mAb (clone R35–118; Pharmingen, San Diego, CA) overnight at 4°C. After washing, color was developed following the procedure for IgG. The purified mouse serum IgE (BD Biosciences, Palo Alto, CA) was used for total IgE standard. To measure HDM-specific IgE, the plate was coated with 25 μg/ml HDM in 0.1 M carbonate buffer (pH 9.6), and serum samples were diluted fivefold in 10% FCS. The concentration of HDM was determined by the preliminary experiments. The procedure after this point was the same as that for measuring HDM-specific IgG. The level of HDM-specific IgE was referenced to the standard serum pooled from six mice that were immunized with 100 μg of HDM twice and inhaled with 10 μg of antigen six times. The standard serum was calculated as 100 ELISA units/ml.
Immunohistochemical staining for CD4+ and CD8+ T cells in lung tissue
The lung tissues from the vaccination and control groups were removed immediately after the final intranasal inhalation. Tissues were fixed with periodate-lysine-paraformaldehyde solution for 24 h at 4°C. The specimens were rinsed with 0.01 M of PBS (pH 7.4) containing 10% to 20% sucrose for 36 h at 4°C, embedded in OCT compound (Miles Laboratories Inc., Elkhart, IN), and immediately frozen. The lung specimens were immersed in 10% EDTA and decalcified for 10 days at 4°C. Frozen sections cut at 4 to 6 μm in thickness were dehydrated and rinsed in cold PBS. The endogenous pseudoperoxidase was blocked with absolute methanol containing 0.5% hydrogen peroxide for 20 min at room temperature. The sections were treated with 10% normal goat serum in PBS to reduce nonspecific binding. Biotin conjugated rat anti-mouse CD8 or CD4 mAb (Pharmingen, San Diego, CA) diluted to 1:200 in PBS containing 0.5% bovine serum albumin was applied to the sections and incubated overnight at 4°C. After rinsing, the sections were incubated with avidin-biotin peroxidase complexes (Vectastain Elite ABC Kit, Vector Laboratories Inc., Burlingame, CA) for 30 min at room temperature and rinsed sufficiently with PBS. The reaction was developed with 0.02% 3,3'-diaminobenzidine in 0.05 M of Tris buffer (pH 7.6) with 0.005% hydrogen peroxidase for 7 min. The sections were dehydrated, cleared in xylene, and mounted.
Histological examination of lung tissue
Mice were anesthetized with a mixture of ketalar (35 mg/ml), rompun (0.6%/ml) and atropine (0.1 mg/ml), of which 0.2 ml was injected intramuscularly. The vascular bed of the lungs was perfused with 0.01 M PBS and then with 4% paraformaldehyde 0.1 M PBS buffers. Whole lungs were taken out and stored in 4% paraformaldehyde for 24 h at 4°C. After fixation, these tissues were dehydrated and embedded in paraffin. Frozen sections cut at 3 μm in thickness were stained by hematoxylin and eosin. After coding, the sections were evaluated by two observers using light microscopy. The amount of inflammation per section was scored using the method described by Hessel et al. [13]. Lungs that showed no focal inflammation were scored as grade 0. Those that showed one or two centrally located microscopic foci of inflammatory infiltrate were graded as 1. In grade 2, a dense inflammatory infiltrate was seen in a perivascular and peribronchial distribution originating in the center of the lung. In grade 3, the perivascular and peribronchial infiltrates extended to the periphery of the lung.
Measuring cytokine mRNA expression
Measuring the expression level was done as previousy described [9]. Briefly, four mice from each group were sacrificed 10 days postboost. The lymph nodes were removed from the mice and minced to create single cell suspensions. Cells were cultured in RPMI for 18 h with no antigen as a negative control, recombinant Der p 1 (100 μg/ml), or HDM crude extract (100 μg/ml). Cells were washed with PBS buffer and mRNAs prepared (Biotech, Houston, TX). By using murine leukemia virus reverse transcriptase and random hexanucleotide primer following the instructions of the Perkin Elmer Gene Amp RNA PCR kit (Perkin Elmer, Branchber, NJ), first-strand cDNA was generated from 1 μg of total RNA and subjected to RT-PCR analysis. We used the primers specific for β-actin (5'- GTGGGCCGCTCTAGGCACCAA -3' and 5'- CTCTTTGATGTCACGCACGATTTC -3') as control primer, IL-2 (5'- TTCAAGCTCCACTTCAAGCTCTACAGCGGAAG -3' and 5'- GACAGAAGGCTATCCATCTCCTCAGAAAGTCC -3'), IFN-γ (5'- TGCATCTTGGCTTTGCAGCTCTTCCTCATGGC -3' and 5'- TGGACCTGTGGGTTGTTGACCTCAAACT TGGC -3') (Clonetech, Palo Alto, CA), IL-4 (5'- CAGCTAGTTGTCATCCTGCTCTTC -3' and 5'- GTGATGTGGACTTGGACTCATTCATGG -3'), or IL-5 (5'- TGTCTGGGCCACTGCCATGGAGATTC -3' and 5'- CCATTGCCCACTCTGTACTCATCACAC -3') in the RT-PCR analysis. The amplified DNAs of β-actin, IFN-γ, IL-2, IL-4, and IL-5 were 540, 365, 413, 354, and 349 base pairs, respectively.
Statistical analysis
Data in immunoglobulin response were analyzed by Student's paired t test for comparisons between control and vaccination groups. Histological grades were analyzed by a nonparametric Mann-Whitney U test. Data were expressed as mean ± SD. A p- value of < 0.05 was considered significant.