Skip to main content

Table 1 Sequence of primers used for cloning rCyn d 1 and of Cyn d 1 fragments and deletion mutants in expression vector pQE30Xa.

From: Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)

Primer Name Sequence (5' – 3')
λgt11Fwd GGTGGCGACGACTCTGGAGCCCG
λgt11Rev TTGACACCAGACCAACTGGTAATG
pQEFwd GTGAGCGGATAACAATTTCACACAG
pQERev GTTCTGAGGTCATTACTGGATC
F1Rev CCATCCTTAAGCTT GAAGATGGGTTCGTTG
F2Rev GATGAGGACAAGCTT GGGCTCGCCGGAGC
F3Rev CTCCTCTCCAAGCTT CTTCTTGGCCCATGGC
F4Rev GCCATCGCCAAGCTT GGCAGCGTACTTCAC
F5Fwd GTGAAGTACAGCGCT GCCGGCGATGGCAAC
F6Fwd CTGCGCAAGAGCGCT GGCGAACTGATG
F7Fwd GCAAGGAGCCCAGCGCT GAGTGCTCCGGC
F8CynFwd GGCGCATGGAGCGCT ATGGGCGACAAGCCG
F8CynRev GCATCAATGCAAGCTT TCAGAACTGGATC
D120Fwd CTCCTCTCCGGATCC CTTCTTGGCCATGGC
D170Fwd GTGAAGTACGCTGGATCC GCCGGCGATGGC
D224Rev GACATCGTCCTGAAGCTT TTCGACATGGCC
  1. The sequences of the 7 overlapping fragments of varying lengths covering the entire rCyn d 1 allergen molecule (previously cloned from the cDNA expression library) were amplified using specific primers designed to introduce restriction sites at both ends and were inserted as Stu1/Hind III-fragments in the correct reading frame downstream from the 6× His tag encoding gene sequence of the pQE30Xa vector. The deletion mutants were cloned using the Bam H1 and Hind III restriction sites on the expression vector. Restriction enzyme sites are italicised and in bold.