Skip to main content

Advertisement

Table 1 Designed primers for genes of interest

From: Amelioration of patients with chronic spontaneous urticaria in treatment with vitamin D supplement

Name Accession number Product length (bp) Sequence (5′ → 3′)
IL-10 NM_000572.2 111 Forward: TTGCTGGAGGACTTTAAGGGT
Reverse: CTTGATGTCTGGGTCTTGGTT
IL-17 NM_000619.2 142 Forward: GTCAACCTGAACATCCATAACCG
Reverse: ACTTTGCCTCCCAGATCACAG
FOXP3 NM_000589.2 95 Forward: ACTACTTCAAGTTCCACAACAGC
Reverse: GAGTGTCCGCTGCTTCTCTG
TGFβ NM_000660.5 192 Forward: GCAAGTGGACATCAACGGG
Reverse: CGCACGCAGCAGTTCTTCTC