Skip to main content

Table 1 Designed primers for genes of interest

From: Amelioration of patients with chronic spontaneous urticaria in treatment with vitamin D supplement

Name Accession number Product length (bp) Sequence (5′ → 3′)
IL-10 NM_000572.2 111 Forward: TTGCTGGAGGACTTTAAGGGT