Skip to main content

Table 1 Intron spanning primers used in the expression analysis.

From: Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMP

Gene CADRE Forward pMol Reverse pMol
Asp f 1 AFUA_5G02330 ACGCTCGTGCG*ACCTGGACATGC 40 GCCGTCGGAAAGAGGTGCGTG 20
Asp f 2 AFUA_4G09580 CTGTGCTTTGGAAG*GCTGGGGCGGCCAC 40 GTCTCCATGTGCTCCCAGGGC 40
Asp f 3 AFUA_6G02280 GGGACGACATT*CTCTTCCTCTCCGAC 40 CGCTCGAGAACTCGAGGTGGTTC 40
Asp f 4 AFUA_2G03830 CAGCTCTTCCCACTCCGACAG 40 CTGGGTTCGGTCCTGCCAC 40
Asp f 5 AFUA_8G07080 TACTCACGGTC*TTTCCAACCGAC 40 GCTTCAGACGGATGGCCGTC 40
Asp f 6 AFUA_1G14550 ACTACCTTCAG*TACTTGAACGAC 100 GTACACGTTCATGAATGGGTG 40
Asp f 7 AFUA_4G06670 GCTCCTATCTTCAAGTCCCT 40 CCACACTACGTCCACTTCAC 40
Asp f 8 AFUA_2G10100 ACCTCCAGGAGCTCATCGCCGAG 20 CTCCTCCTTCTTCTCCTCAG 40
Asp f 9 AFUA_1G16190 GAGGTTGACTGG*GAAGTATTG 40 GAAAGTCTCCTGAGGAGTG 10
Asp f 10 AFUA_5G13300 GCGGCATTGCTG*ACACCGGC 40 GCAGGGGAAGACATAACCACCG 40
Asp f 11 AFUA_2G03720 GGTCCTAACAC*CAACGGC 40 GAGCTTCGATCTCCTTGAC 40
Asp f 12 AFUA_5G04170 TGACCAAGGCT*GATTTGATC 40 CAACAAGGTAAGCAGAGTAG 40
Asp f 13 AFUA_4G11800 GAGCGCAGAC*GTTGCCCATG 40 CCTTGTGGGAAATGCTGCCCAG 40
Asp f 17 AFUA_4G03240 ACCATCAACTCCGGTGTCGAC 10 CTTGGAGATGAGGTCGTCG 40
Asp f 18 AFUA_5G09210 CTCCCAAC*CTCCTTGCCTG 40 CTCGGCCTTGTGAACTAG 40
Asp f 22 AFUA_6G06770 CATGATCGTCCCTGA*CTCCGC 40 CACCCTCGTCACCAACGTTG 40
Asp f 23 AFUA_2G11850 GCAGATTACTCC*CATGGGTG 40 GTACAGGGTCTTGCGCAG 40
Actin AFUA_6G04740 TCATCATGCGCGACAGC 10 CAATCATGATA*CCATGGTGAC 40
β-tubulin AFUA_1G10910 CGACAACGAG*GCTCTGTACG 40 CAACTTGCGCAGATCAGAGTTGAG 40
GpdA AFUA_5G01970 GGCGAGCTCAAGAACATCCTCGGCTA 20 CTTGGCGATGTAGGCGATAAGGTCGA 20
FksA AFUA_6G12400 GCTGCGCCCAAG*TCGCCAAATC 40 GAACAACAAGTGGGGCAATG 20
  1. As part of the initial work up for these experiments primer concentrations were optimized so that all allergens could be analysed using a single annealing temperature in the PCR. Primer levels used are indicated. Primers used to establish the most useful comparator are also included.
  2. pMol = pMol primer used per 25 μl reaction mix; * - intron site